Novoprotein Scientific Cd79B

Lab Reagents

Human IgG antibody Laboratories manufactures the novoprotein scientific cd79b reagents distributed by Genprice. The Novoprotein Scientific Cd79B reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Novoprotein. Other Novoprotein products are available in stock. Specificity: Novoprotein Category: Scientific Group: Cd79B

Cd79B information

CD79B Antibody

32563-100ul 100ul
EUR 252

CD79B Antibody

DF6767 200ul
EUR 304
Description: CD79B Antibody detects endogenous levels of total CD79B.

CD79B Antibody

CSB-PA004958KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CD79B Antibody

CSB-PA004958KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CD79B Antibody

1-CSB-PA004958LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CD79B Antibody

1-CSB-PA005233
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

anti-CD79b

YF-PA10819 50 ul
EUR 363
Description: Mouse polyclonal to CD79b

anti-CD79b

YF-PA10820 50 ug
EUR 363
Description: Mouse polyclonal to CD79b

anti-CD79b

YF-PA10821 100 ul
EUR 403
Description: Rabbit polyclonal to CD79b

anti-CD79b

YF-PA10822 100 ug
EUR 403
Description: Rabbit polyclonal to CD79b

anti-CD79b

YF-PA23403 50 ul
EUR 334
Description: Mouse polyclonal to CD79b

CD79B Blocking Peptide

AF4649-BP 1mg
EUR 195

CD79B cloning plasmid

CSB-CL004958HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 240
  • Sequence: atggccaggctggcgttgtctcctgtgcccagccactggatggtggcgttgctgctgctgctctcaggtacagaacccacgacgaggcctgtggggtttgctctcatctccagctgtctgggccctgcggctctgcctcctgcttgctccaccctcctcctctgtctctcactctt
  • Show more
Description: A cloning plasmid for the CD79B gene.

CD79B cloning plasmid

CSB-CL004958HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Sequence: atggccaggctggcgttgtctcctgtgcccagccactggatggtggcgttgctgctgctgctctcagctgagccagtaccagcagccagatcggaggaccggtaccggaatcccaaaggtagtgcttgttcgcggatctggcagagcccacgtttcatagccaggaaacggggctt
  • Show more
Description: A cloning plasmid for the CD79B gene.

CD79b Polyclonal Antibody

ES3985-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD79b from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD79b Polyclonal Antibody

ES3985-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD79b from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD79b Polyclonal Antibody

ABP52986-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD79b
  • Applications tips:
Description: A polyclonal antibody for detection of CD79b from Human. This CD79b antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD79b