Equitech Bio Cat 21-031

Lab Reagents

Equitech Bio Laboratories manufactures the equitech bio cat 21-031 reagents distributed by Genprice. The Equitech Bio Cat 21-031 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Equitech Bio. Other Equitech products are available in stock. Specificity: Equitech Category: Bio Group: Cat 21-031

Cat 21-031 information

Human Catalase (CAT) ELISA Kit
DLR-CAT-Hu-48T	DL Develop	48T	EUR 441
Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit
DLR-CAT-Hu-96T	DL Develop	96T	EUR 570
Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit
DLR-CAT-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit
DLR-CAT-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit
DLR-CAT-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit
DLR-CAT-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit
RDR-CAT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 455

Human Catalase (CAT) ELISA Kit
RDR-CAT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 629

Mouse Catalase (CAT) ELISA Kit
RDR-CAT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Catalase (CAT) ELISA Kit
RDR-CAT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Catalase (CAT) ELISA Kit
RDR-CAT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Catalase (CAT) ELISA Kit
RDR-CAT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Catalase (CAT) ELISA Kit
RD-CAT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Catalase (CAT) ELISA Kit
RD-CAT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Mouse Catalase (CAT) ELISA Kit
RD-CAT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Catalase (CAT) ELISA Kit
RD-CAT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Catalase (CAT) ELISA Kit
RD-CAT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Catalase (CAT) ELISA Kit
RD-CAT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

IL-21, Interleukin-21, human
RC212-32	Bio Basic	2ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

IL-21, Interleukin-21, rat
RC252-32	Bio Basic	2ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

XMIRXpress lentivector miRNA-21-5p with Xmotif
XMIRXP-21	SBI	10 ug	EUR 677
Category: Exosome

1L DPBS 1X (WITHOUT CALCIUM AND MAGNESIUM)
21-031-CM	CORNING	1 L/pk	EUR 78
Description: Media Catalog; Buffered Salt-Salution

500 ML DPBS 1X (WITHOUT CALCIUM AND MAGNESIUM)
21-031-CV	CORNING	500 mL/pk	EUR 52
Description: Media Catalog; Buffered Salt-Salution

20 L DPBS (DULBECCO'S PHOSPHATE-BUFFERED SALINE), 1X WITHOUT CALCIUM AND MAGNESIUM
21-031-LB	CORNING	20 L/pk	EUR 234
Description: Media Catalog; Buffered Salt-Salution

10 L DPBS (DULBECCO'S PHOSPHATE-BUFFERED SALINE), 1X WITHOUT CALCIUM AND MAGNESIUM
21-031-LX	CORNING	10 L/pk	EUR 167
Description: Media Catalog; Buffered Salt-Salution

BIO-acetoxime
B5488-25	ApexBio	25 mg	EUR 374

BIO-acetoxime
B5488-5	ApexBio	5 mg	EUR 137

BIO-acetoxime
B5488-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 189

BIO 5192
B7741-10	ApexBio	10 mg	EUR 470
Description: BIO5192 is a small molecule inhibitor of integrin ?4?1 with an IC50 value of 1.8 ± 0.7 nM [1].Integrin ?4?1 is important in inflammatory processes.

BIO 5192
B7741-50	ApexBio	50 mg	EUR 1819
Description: BIO5192 is a small molecule inhibitor of integrin ?4?1 with an IC50 value of 1.8 ± 0.7 nM [1].Integrin ?4?1 is important in inflammatory processes.

BIO 1211
A8663-1	ApexBio	1 mg	EUR 324
Description: BIO 1211 is a selective and high affinity inhibitor of ?4?1 with IC50 value of 0.004uM [1].The leukocyte integrin ?4?1 mediates leukocyte recruitment, activation, apoptosis inhibition and mediator release, it plays an important role in inflammatory responses [1].

BIO-acetoxime
HY-15356	MedChemExpress	100mg	EUR 899

FGF-21, Fibroblast Growth Factor-21, human
RC215-32	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

FGF-21, rat
RC255-32	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

IL-10, Interleukin-10, human
RC212-21	Bio Basic	2ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

B-Cell Maturation Antigen, BCMA, human
RC214-21	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

FGF-10, Fibroblast Growth Factor-10, human
RC215-21	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

PDGF-BB, human
RC216-21	Bio Basic	2ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Growth Factors

NRG-1, NRG-1 EGF-like, human
RC218-21	Bio Basic	50ug	EUR 169.63
Product category: Proteins/Recombinant Proteins/Growth Factors

IL-10, Interleukin-10, murine (mouse)
RC232-21	Bio Basic	2ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

FGF-10, murine (mouse)
RC235-21	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

IL-10, Interleukin-10, rat
RC252-21	Bio Basic	2ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

FGF-10, rat
RC255-21	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

IP-10, CXCL10, human
RC312-21	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

IP-10, CXCL10, monkey
RC322-21	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

IP-10, CXCL10, murine (mouse)
RC332-21	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

IP-10, CXCL10, rat
RC352-21	Bio Basic	5ug	EUR 101.33
Product category: Proteins/Recombinant Proteins/Cytokines

UBC10, Ubiquitin Conjugating Enzyme 10 (His6-tagged), human
RC612-21	Bio Basic	50ug	EUR 169.63
Product category: Proteins/Recombinant Proteins/Ubiquitins

Bio-SAM b
ACT00202-100	Arthus	100µg	EUR 543
Description: Biotin is conjugated to NH2 group of S-adenosylmethionine.

Bio-SAM a
ACT00202-50	Arthus	50µg	EUR 319
Description: Biotin is conjugated to NH2 group of S-adenosylmethionine.

Bio-SAH b
ACT00302-100	Arthus	100µg	EUR 543
Description: Biotin is conjugated to NH2 group of S-adenosylhomocysteine.

Bio-SAH a
ACT00302-50	Arthus	50µg	EUR 319
Description: Biotin is conjugated to NH2 group of S-adenosylhomocysteine.

meter bio-electronic
C3050	Consort	ea	EUR 1197

FGF-21, murine (mouse)
RC235-32	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

Sealing film, qPCR Optical (sticky adhesive film) Bio-Rad Type, 100/pk
P1001-Q	MTC Bio	100/pack	EUR 122.9
Description: Sealing film qPCR Optical (sticky adhesive film) Bio-Rad Type

Recombinant ASFV BA71R-031 Protein
VAng-1959Lsx-inquire	Creative Biolabs	inquire	Ask for price
Description: African swine fever virus (strain Badajoz 1971 Vero-adapted) Protein MGF 505-10R (BA71R-031), partial, recombinant protein from E. coli. (Uniprot ID: Q89869)

Recombinant ASFV Mal-031 Protein
VAng-2158Lsx-inquire	Creative Biolabs	inquire	Ask for price
Description: African swine fever virus (isolate Tick/Malawi/Lil 20-1/1983) Protein MGF 505-1R (Mal-031), partial, recombinant protein from E. coli. (Uniprot ID: Q65124)

Bio-6C-SAM 1b
ACT00203-100	Arthus	100µg	EUR 728
Description: Biotin is conjugated to NH2 of SAM through 6-aminohexanoic acid.

Bio-6C-SAM 1a
ACT00203-50	Arthus	50µg	EUR 416
Description: Biotin is conjugated to NH2 of SAM through 6-aminohexanoic acid.

Bio-6C-SAH 1b
ACT00303-100	Arthus	100µg	EUR 806
Description: Biotin is conjugated to NH2 of SAH through 6-aminohexanoic acid.

Bio-6C-SAH 1a
ACT00303-50	Arthus	50µg	EUR 475
Description: Biotin is conjugated to NH2 of SAH through 6-aminohexanoic acid.

Bio-12CN-SAH 1a
ACT00305-10	Arthus	10µg	EUR 202
Description: Biotin is conjugated to NH2 of SAH through a 10-carbon and 2-nitrogen linker.

Bio-12CN-SAH 1c
ACT00305-100	Arthus	100µg	EUR 923
Description: Biotin is conjugated to NH2 of SAH through a 10-carbon and 2-nitrogen linker.

Bio-12CN-SAH 1b
ACT00305-50	Arthus	50µg	EUR 533
Description: Biotin is conjugated to NH2 of SAH through a 10-carbon and 2-nitrogen linker.

BIO-11006 acetate salt
HY-106377A	MedChemExpress	10mM/1mL	EUR 821

pTT3- CD109- bio- His
PVT10241	Lifescience Market	2 ug	EUR 301

p16-INK4a, Cyclin-dependent Kinase Inhibitor 2A, human
RC712-21+A197	Bio Basic	50ug	EUR 152.66
Product category: Proteins/Recombinant Proteins/Other

Mouse pre-microRNA Expression Construct mir-21
MMIR-21-PA-1	SBI	Bacterial Streak	EUR 684
Category: MicroRNA Tools

GSK-3 Inhibitor IX (BIO)
B1538-10	ApexBio	10 mg	EUR 168
Description: GSK-3 inhibitor IX (BIO) is a potent, selective, cell-permeable, ATP-competitive and reversible inhibitor of GSK-3? (glycogen synthase kinase-3?) and GSK-3? (lycogen synthase kinase-3?) (IC50 = 5nM for GSK-3?).

GSK-3 Inhibitor IX (BIO)
B1538-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 174
Description: GSK-3 inhibitor IX (BIO) is a potent, selective, cell-permeable, ATP-competitive and reversible inhibitor of GSK-3? (glycogen synthase kinase-3?) and GSK-3? (lycogen synthase kinase-3?) (IC50 = 5nM for GSK-3?).

GSK-3 Inhibitor IX (BIO)
B1538-50	ApexBio	50 mg	EUR 512
Description: GSK-3 inhibitor IX (BIO) is a potent, selective, cell-permeable, ATP-competitive and reversible inhibitor of GSK-3? (glycogen synthase kinase-3?) and GSK-3? (lycogen synthase kinase-3?) (IC50 = 5nM for GSK-3?).

Bio-6C-aza-SAM 1a
ACT00205-10	Arthus	10µg	EUR 202
Description: Biotin is conjugated to the NH2 of aza-SAM through 6-aminohexanoic acid.

Bio-6C-aza-SAM 1c
ACT00205-100	Arthus	100µg	EUR 933
Description: Biotin is conjugated to the NH2 of aza-SAM through 6-aminohexanoic acid.

Bio-6C-aza-SAM 1b
ACT00205-50	Arthus	50µg	EUR 543
Description: Biotin is conjugated to the NH2 of aza-SAM through 6-aminohexanoic acid.

Bio-12CN-aza-SAM 1a
ACT00206-10	Arthus	10µg	EUR 241
Description: Biotin is conjugated to the NH2 of aza-SAM through a 10-carbon and 2-nitrogen linker.

Bio-12CN-aza-SAM 1c
ACT00206-100	Arthus	100µg	EUR 1030
Description: Biotin is conjugated to the NH2 of aza-SAM through a 10-carbon and 2-nitrogen linker.

Bio-12CN-aza-SAM 1b
ACT00206-50	Arthus	50µg	EUR 631
Description: Biotin is conjugated to the NH2 of aza-SAM through a 10-carbon and 2-nitrogen linker.

kit c3050 bio-electronic agro
C3050A	Consort	ea	EUR 1839

BIO, 6-Bromoindirubin-3′-Oxime
BC2001-001	GenDepot	1mg	EUR 182

BIO, 6-Bromoindirubin-3′-Oxime
BC2001-010	GenDepot	10 mg	EUR 313

BIO, 6-Bromoindirubin-3′-Oxime
BC2001-050	GenDepot	50 mg	EUR 840

ExoPure? Isolation Kit   (Bio Fluids)
K1241-10	Biovision		EUR 697

ExoPure? Isolation Kit   (Bio Fluids)
K1241-2	Biovision		EUR 403

CAT/ Rat CAT ELISA Kit
ELA-E0242r	Lifescience Market	96 Tests	EUR 886

IgE (Immune globulin E) ELISA test
21	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of IgE (Immune globulin)

CAT antibody
20C-CR1111RP	Fitzgerald	500 ul	EUR 262
Description: Rabbit polyclonal CAT antibody

CAT antibody
70R-16187	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CAT antibody

CAT Antibody
36312-100ul	SAB	100ul	EUR 252

Cat IgM
31C-CH0213	Fitzgerald	1 mg	EUR 392
Description: Purified Cat IgM

CAT antibody
10R-3584	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal CAT antibody

CAT antibody
10R-3585	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CAT antibody

CAT Antibody
1-CSB-PA004563GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CAT Antibody
1-CSB-PA004980	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CAT Antibody
1-CSB-PA070043	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

CAT Antibody
1-CSB-PA599838	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CAT Antibody
1-CSB-PA942303	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

CAT siRNA
20-abx900807	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CAT siRNA
20-abx910366	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CAT siRNA
20-abx910367	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pCas9- CAT
PVT11001	Lifescience Market	2 ug	EUR 301

pOTB7-CAT
PVT18217	Lifescience Market	2 ug	EUR 231

Bio-Star Mastermix for probes (2X)
P120	GeneOn	100 rcs (2,5 ml)	EUR 94

Bio-Star Mastermix (2X) High-ROX
P140	GeneOn	100 rcs (2,5 ml)	EUR 102

Bio-Star Mastermix (2X) Low-ROX
P150	GeneOn	100 rcs (2,5 ml)	EUR 102

Recombinant ASFV Ken-031 Protein (aa 1-319)
VAng-0808Lsx-1mg	Creative Biolabs	1 mg	EUR 4504
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7)

Recombinant ASFV Ken-031 Protein (aa 1-319)
VAng-0808Lsx-500g	Creative Biolabs	500 µg	EUR 2993
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7)

Recombinant ASFV Ken-031 Protein (aa 1-319)
VAng-0808Lsx-50g	Creative Biolabs	50 µg	EUR 2044
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7)

Recombinant ASFV War-031 Protein (aa 1-353)
VAng-0996Lsx-1mg	Creative Biolabs	1 mg	EUR 4724
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6)

Recombinant ASFV War-031 Protein (aa 1-353)
VAng-0996Lsx-500g	Creative Biolabs	500 µg	EUR 3143
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6)

Recombinant ASFV War-031 Protein (aa 1-353)
VAng-0996Lsx-50g	Creative Biolabs	50 µg	EUR 2154
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6)

Recombinant ASFV Pret-031 Protein (aa 1-352)
VAng-2323Lsx-1mg	Creative Biolabs	1 mg	EUR 4724
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2)

Recombinant ASFV Pret-031 Protein (aa 1-352)
VAng-2323Lsx-500g	Creative Biolabs	500 µg	EUR 3143
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2)

Recombinant ASFV Pret-031 Protein (aa 1-352)
VAng-2323Lsx-50g	Creative Biolabs	50 µg	EUR 2140
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2)

Bio-Star Mastermix with SYBR (2X) BLUE
Y220	GeneOn	100 rcs (2,5 ml)	EUR 94

Cat RBC antibody
20R-RR015	Fitzgerald	20 mg	EUR 327
Description: Rabbit polyclonal Cat RBC antibody

Cat RBC antibody
20R-RR016	Fitzgerald	5 mg	EUR 554
Description: Rabbit polyclonal Cat RBC antibody

Feline Cat IgG
31-1005	Fitzgerald	5 mg	EUR 175
Description: Feline (Cat) IgG Purified-Protein A

b-cat antibody
70R-21460	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal b-cat antibody

Cat IgG (FITC)
65C-CH0202	Fitzgerald	1 mg	EUR 227
Description: Purified Cat IgG FITC conjugate

Cat IgG (HRP)
65C-CH0203	Fitzgerald	1 mg	EUR 248
Description: Purified Cat IgG HRP conjugate

CAT Rabbit pAb
A11777-100ul	Abclonal	100 ul	EUR 308

CAT Rabbit pAb
A11777-200ul	Abclonal	200 ul	EUR 459

CAT Rabbit pAb
A11777-20ul	Abclonal	20 ul	EUR 183

CAT Rabbit pAb
A11777-50ul	Abclonal	50 ul	EUR 223

CAT Rabbit pAb
A11780-100ul	Abclonal	100 ul	EUR 308

CAT Rabbit pAb
A11780-200ul	Abclonal	200 ul	EUR 459

CAT Rabbit pAb
A11780-20ul	Abclonal	20 ul	EUR 183

CAT Rabbit pAb
A11780-50ul	Abclonal	50 ul	EUR 223

Normal Cat Serum
88R-1026	Fitzgerald	10 ml	EUR 250
Description: Normal Cat Serum which has been lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2

Catalase (CAT) Antibody
abx025488-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx004037	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx214177	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx175722	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Catalase (CAT) Antibody
20-abx100146	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Catalase (CAT) Antibody
20-abx100147	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Catalase (CAT) Antibody
20-abx100148	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Catalase (CAT) Antibody
20-abx100149	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Catalase (CAT) Antibody
20-abx100150	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Catalase (CAT) Antibody
20-abx100151	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Catalase (CAT) Antibody
20-abx111432	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx125619	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx125620	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx132110	Abbexa	EUR 272.00 EUR 592.00 EUR 314.00 EUR 154.00 EUR 230.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Catalase (CAT) Antibody
20-abx132122	Abbexa	EUR 300.00 EUR 718.00 EUR 384.00 EUR 154.00 EUR 244.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

PKA CAT Antibody
abx147539-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx148940	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx141181	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx171619	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Cat Uromodulin Enzyme
20-abx073947	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	0.1 mg 10 ug 2 µg
Shipped within 5-10 working days.

Catalase (CAT) Antibody
abx034033-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Catalase (CAT) Antibody
abx034033-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx242079	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

PKA CAT Antibody
AF5450	Affbiotech	200ul	EUR 304
Description: PKA CAT Antibody detects endogenous levels of total PKA CAT.

CAT Conjugated Antibody
C36312	SAB	100ul	EUR 397

Catalase (CAT) Antibody
20-abx326479	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx323535	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Catalase (CAT) Antibody
abx430824-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Catalase (CAT) Antibody
abx231301-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

PKA CAT Antibody
AF7746	Affbiotech	200ul	EUR 376
Description: PKA CAT Antibody detects endogenous levels of PKA CAT.

CAT cloning plasmid
CSB-CL004563HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1584 Sequence: ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTG Show more
Description: A cloning plasmid for the CAT gene.

PKA CAT Antibody
ABF5450	Lifescience Market	100 ug	EUR 438

CAT Rabbit pAb
A5275-100ul	Abclonal	100 ul	EUR 308

CAT Rabbit pAb
A5275-200ul	Abclonal	200 ul	EUR 459

CAT Rabbit pAb
A5275-20ul	Abclonal	20 ul	Ask for price

CAT Rabbit pAb
A5275-50ul	Abclonal	50 ul	Ask for price

Recombinant Human CAT
P0501	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P04040
Description: Recombinant Human protein for CAT

pCEP4- CAT Plasmid
PVT1038	Lifescience Market	2 ug	EUR 266

Rat Catalase (CAT)
QY-E11654	Qayee Biotechnology	96T	EUR 374

Recombinant Catalase (CAT)
4-RPC418Hu01	Cloud-Clone	EUR 279.20 EUR 178.00 EUR 772.00 EUR 324.00 EUR 548.00 EUR 250.00 EUR 1780.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04040 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Hu02	Cloud-Clone	EUR 279.20 EUR 178.00 EUR 772.00 EUR 324.00 EUR 548.00 EUR 250.00 EUR 1780.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04040 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 58.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Hu03	Cloud-Clone	EUR 279.20 EUR 178.00 EUR 772.00 EUR 324.00 EUR 548.00 EUR 250.00 EUR 1780.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04040 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Hu04	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04040 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Mu01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P24270 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Mu02	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P24270 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.5kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

pCMV-SPORT6-CAT
PVT14338	Lifescience Market	2 ug	EUR 495

Anti-CAT antibody
STJ27228	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody
STJ113361	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody
STJ113364	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody
STJ119991	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Catalase (10,000-15,000 U/mg), Bovine Liver
CAT-01	Alpha Diagnostics	25 mU	EUR 529

Catalase (2000-4000 U/mg), Aspergillus Niger
CAT-02	Alpha Diagnostics	25 mU	EUR 651

Catalase (4000-6000 U/mg), Bovine Liver
CAT-03	Alpha Diagnostics	5 mU	EUR 347

Catalase (>40,000 u/mg), Bovine Liver
CAT-04	Alpha Diagnostics	1 mg	EUR 286

anti-XPA (human) antibody, monoclonal
70-031	Sceti	50ug	EUR 414
Description: The anti-XPA (human) antibody, monoclonal is available in Europe and for worldwide shipping via Gentaur.

Pfu DNA polymerase (-dNTPs)
02-031	Sceti	200U	EUR 166
Description: The Pfu DNA polymerase (-dNTPs) is available in Europe and for worldwide shipping via Gentaur.

Recombinant Dengue Virus Subtype 3 EP (aa 281-673)
DAGF-031	Creative Diagnostics	2 ug	EUR 372

Recombinant Mouse C1s1 Protein
CTP-031	Creative Biolabs	100ug	Ask for price
Description: A recombinant mouse C1s1 protein with a N-terminal tag or C-terminal tag expressed in E. coli, yeast, insect, or mammalian cells.

IGF1
E21-031	EnoGene	10ug	EUR 343

Goat Anti-Malondialdehyde (MDA) Polyclonal Antibody
STA-031	Cell Biolabs	100 µg	EUR 508
Description: Goat Anti-Malondialdehyde Polyclonal Antibody is Affinity purified and suitable for Western blot or ELISA. Suitable for use with any species. 100 µg.