Equitech Bio Cat 21-031

Lab Reagents

Equitech Bio Laboratories manufactures the equitech bio cat 21-031 reagents distributed by Genprice. The Equitech Bio Cat 21-031 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Equitech Bio. Other Equitech products are available in stock. Specificity: Equitech Category: Bio Group: Cat 21-031

Cat 21-031 information

Human Catalase (CAT) ELISA Kit

DLR-CAT-Hu-48T 48T
EUR 441
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit

DLR-CAT-Hu-96T 96T
EUR 570
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit

DLR-CAT-Mu-48T 48T
EUR 527
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit

DLR-CAT-Mu-96T 96T
EUR 688
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit

DLR-CAT-Ra-48T 48T
EUR 549
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit

DLR-CAT-Ra-96T 96T
EUR 718
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit

RDR-CAT-Hu-48Tests 48 Tests
EUR 455

Human Catalase (CAT) ELISA Kit

RDR-CAT-Hu-96Tests 96 Tests
EUR 629

Mouse Catalase (CAT) ELISA Kit

RDR-CAT-Mu-48Tests 48 Tests
EUR 557

Mouse Catalase (CAT) ELISA Kit

RDR-CAT-Mu-96Tests 96 Tests
EUR 774

Rat Catalase (CAT) ELISA Kit

RDR-CAT-Ra-48Tests 48 Tests
EUR 583

Rat Catalase (CAT) ELISA Kit

RDR-CAT-Ra-96Tests 96 Tests
EUR 811

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-48Tests 48 Tests
EUR 436

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-96Tests 96 Tests
EUR 601

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-48Tests 48 Tests
EUR 533

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-96Tests 96 Tests
EUR 740

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-48Tests 48 Tests
EUR 557

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-96Tests 96 Tests
EUR 775

IL-21, Interleukin-21, human

RC212-32 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IL-21, Interleukin-21, rat

RC252-32 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

XMIRXpress lentivector miRNA-21-5p with Xmotif

XMIRXP-21 10 ug
EUR 677
  • Category: Exosome

1L DPBS 1X (WITHOUT CALCIUM AND MAGNESIUM)

21-031-CM 1 L/pk
EUR 78
Description: Media Catalog; Buffered Salt-Salution

500 ML DPBS 1X (WITHOUT CALCIUM AND MAGNESIUM)

21-031-CV 500 mL/pk
EUR 52
Description: Media Catalog; Buffered Salt-Salution

20 L DPBS (DULBECCO'S PHOSPHATE-BUFFERED SALINE), 1X WITHOUT CALCIUM AND MAGNESIUM

21-031-LB 20 L/pk
EUR 234
Description: Media Catalog; Buffered Salt-Salution

10 L DPBS (DULBECCO'S PHOSPHATE-BUFFERED SALINE), 1X WITHOUT CALCIUM AND MAGNESIUM

21-031-LX 10 L/pk
EUR 167
Description: Media Catalog; Buffered Salt-Salution

BIO-acetoxime

B5488-25 25 mg
EUR 374

BIO-acetoxime

B5488-5 5 mg
EUR 137

BIO-acetoxime

B5488-5.1 10 mM (in 1mL DMSO)
EUR 189

BIO 5192

B7741-10 10 mg
EUR 470
Description: BIO5192 is a small molecule inhibitor of integrin ?4?1 with an IC50 value of 1.8 ± 0.7 nM [1].Integrin ?4?1 is important in inflammatory processes.

BIO 5192

B7741-50 50 mg
EUR 1819
Description: BIO5192 is a small molecule inhibitor of integrin ?4?1 with an IC50 value of 1.8 ± 0.7 nM [1].Integrin ?4?1 is important in inflammatory processes.

BIO 1211

A8663-1 1 mg
EUR 324
Description: BIO 1211 is a selective and high affinity inhibitor of ?4?1 with IC50 value of 0.004uM [1].The leukocyte integrin ?4?1 mediates leukocyte recruitment, activation, apoptosis inhibition and mediator release, it plays an important role in inflammatory responses [1].

BIO-acetoxime

HY-15356 100mg
EUR 899

FGF-21, Fibroblast Growth Factor-21, human

RC215-32 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

FGF-21, rat

RC255-32 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IL-10, Interleukin-10, human

RC212-21 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

B-Cell Maturation Antigen, BCMA, human

RC214-21 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

FGF-10, Fibroblast Growth Factor-10, human

RC215-21 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

PDGF-BB, human

RC216-21 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Growth Factors

NRG-1, NRG-1 EGF-like, human

RC218-21 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Growth Factors

IL-10, Interleukin-10, murine (mouse)

RC232-21 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

FGF-10, murine (mouse)

RC235-21 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IL-10, Interleukin-10, rat

RC252-21 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

FGF-10, rat

RC255-21 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IP-10, CXCL10, human

RC312-21 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IP-10, CXCL10, monkey

RC322-21 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IP-10, CXCL10, murine (mouse)

RC332-21 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IP-10, CXCL10, rat

RC352-21 5ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Cytokines

UBC10, Ubiquitin Conjugating Enzyme 10 (His6-tagged), human

RC612-21 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Ubiquitins

Bio-SAM b

ACT00202-100 100µg
EUR 543
Description: Biotin is conjugated to NH2 group of S-adenosylmethionine.

Bio-SAM a

ACT00202-50 50µg
EUR 319
Description: Biotin is conjugated to NH2 group of S-adenosylmethionine.

Bio-SAH b

ACT00302-100 100µg
EUR 543
Description: Biotin is conjugated to NH2 group of S-adenosylhomocysteine.

Bio-SAH a

ACT00302-50 50µg
EUR 319
Description: Biotin is conjugated to NH2 group of S-adenosylhomocysteine.

meter bio-electronic

C3050 ea
EUR 1197

FGF-21, murine (mouse)

RC235-32 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Sealing film, qPCR Optical (sticky adhesive film) Bio-Rad Type, 100/pk

P1001-Q 100/pack
EUR 122.9
Description: Sealing film qPCR Optical (sticky adhesive film) Bio-Rad Type

Recombinant ASFV BA71R-031 Protein

VAng-1959Lsx-inquire inquire Ask for price
Description: African swine fever virus (strain Badajoz 1971 Vero-adapted) Protein MGF 505-10R (BA71R-031), partial, recombinant protein from E. coli. (Uniprot ID: Q89869)

Recombinant ASFV Mal-031 Protein

VAng-2158Lsx-inquire inquire Ask for price
Description: African swine fever virus (isolate Tick/Malawi/Lil 20-1/1983) Protein MGF 505-1R (Mal-031), partial, recombinant protein from E. coli. (Uniprot ID: Q65124)

Bio-6C-SAM 1b

ACT00203-100 100µg
EUR 728
Description: Biotin is conjugated to NH2 of SAM through 6-aminohexanoic acid.

Bio-6C-SAM 1a

ACT00203-50 50µg
EUR 416
Description: Biotin is conjugated to NH2 of SAM through 6-aminohexanoic acid.

Bio-6C-SAH 1b

ACT00303-100 100µg
EUR 806
Description: Biotin is conjugated to NH2 of SAH through 6-aminohexanoic acid.

Bio-6C-SAH 1a

ACT00303-50 50µg
EUR 475
Description: Biotin is conjugated to NH2 of SAH through 6-aminohexanoic acid.

Bio-12CN-SAH 1a

ACT00305-10 10µg
EUR 202
Description: Biotin is conjugated to NH2 of SAH through a 10-carbon and 2-nitrogen linker.

Bio-12CN-SAH 1c

ACT00305-100 100µg
EUR 923
Description: Biotin is conjugated to NH2 of SAH through a 10-carbon and 2-nitrogen linker.

Bio-12CN-SAH 1b

ACT00305-50 50µg
EUR 533
Description: Biotin is conjugated to NH2 of SAH through a 10-carbon and 2-nitrogen linker.

BIO-11006 acetate salt

HY-106377A 10mM/1mL
EUR 821

pTT3- CD109- bio- His

PVT10241 2 ug
EUR 301

p16-INK4a, Cyclin-dependent Kinase Inhibitor 2A, human

RC712-21+A197 50ug
EUR 152.66
  • Product category: Proteins/Recombinant Proteins/Other

Mouse pre-microRNA Expression Construct mir-21

MMIR-21-PA-1 Bacterial Streak
EUR 684
  • Category: MicroRNA Tools

GSK-3 Inhibitor IX (BIO)

B1538-10 10 mg
EUR 168
Description: GSK-3 inhibitor IX (BIO) is a potent, selective, cell-permeable, ATP-competitive and reversible inhibitor of GSK-3? (glycogen synthase kinase-3?) and GSK-3? (lycogen synthase kinase-3?) (IC50 = 5nM for GSK-3?).

GSK-3 Inhibitor IX (BIO)

B1538-5.1 10 mM (in 1mL DMSO)
EUR 174
Description: GSK-3 inhibitor IX (BIO) is a potent, selective, cell-permeable, ATP-competitive and reversible inhibitor of GSK-3? (glycogen synthase kinase-3?) and GSK-3? (lycogen synthase kinase-3?) (IC50 = 5nM for GSK-3?).

GSK-3 Inhibitor IX (BIO)

B1538-50 50 mg
EUR 512
Description: GSK-3 inhibitor IX (BIO) is a potent, selective, cell-permeable, ATP-competitive and reversible inhibitor of GSK-3? (glycogen synthase kinase-3?) and GSK-3? (lycogen synthase kinase-3?) (IC50 = 5nM for GSK-3?).

Bio-6C-aza-SAM 1a

ACT00205-10 10µg
EUR 202
Description: Biotin is conjugated to the NH2 of aza-SAM through 6-aminohexanoic acid.

Bio-6C-aza-SAM 1c

ACT00205-100 100µg
EUR 933
Description: Biotin is conjugated to the NH2 of aza-SAM through 6-aminohexanoic acid.

Bio-6C-aza-SAM 1b

ACT00205-50 50µg
EUR 543
Description: Biotin is conjugated to the NH2 of aza-SAM through 6-aminohexanoic acid.

Bio-12CN-aza-SAM 1a

ACT00206-10 10µg
EUR 241
Description: Biotin is conjugated to the NH2 of aza-SAM through a 10-carbon and 2-nitrogen linker.

Bio-12CN-aza-SAM 1c

ACT00206-100 100µg
EUR 1030
Description: Biotin is conjugated to the NH2 of aza-SAM through a 10-carbon and 2-nitrogen linker.

Bio-12CN-aza-SAM 1b

ACT00206-50 50µg
EUR 631
Description: Biotin is conjugated to the NH2 of aza-SAM through a 10-carbon and 2-nitrogen linker.

kit c3050 bio-electronic agro

C3050A ea
EUR 1839

BIO, 6-Bromoindirubin-3′-Oxime

BC2001-001 1mg
EUR 182

BIO, 6-Bromoindirubin-3′-Oxime

BC2001-010 10 mg
EUR 313

BIO, 6-Bromoindirubin-3′-Oxime

BC2001-050 50 mg
EUR 840

ExoPure? Isolation Kit   (Bio Fluids)

K1241-10
EUR 697

ExoPure? Isolation Kit   (Bio Fluids)

K1241-2
EUR 403

CAT/ Rat CAT ELISA Kit

ELA-E0242r 96 Tests
EUR 886

IgE (Immune globulin E) ELISA test

21 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of IgE (Immune globulin)

CAT antibody

20C-CR1111RP 500 ul
EUR 262
Description: Rabbit polyclonal CAT antibody

CAT antibody

70R-16187 50 ul
EUR 435
Description: Rabbit polyclonal CAT antibody

CAT Antibody

36312-100ul 100ul
EUR 252

Cat IgM

31C-CH0213 1 mg
EUR 392
Description: Purified Cat IgM

CAT antibody

10R-3584 100 ul
EUR 726
Description: Mouse monoclonal CAT antibody

CAT antibody

10R-3585 100 ul
EUR 691
Description: Mouse monoclonal CAT antibody

CAT Antibody

1-CSB-PA004563GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CAT Antibody

1-CSB-PA004980
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CAT Antibody

1-CSB-PA070043
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

CAT Antibody

1-CSB-PA599838
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CAT Antibody

1-CSB-PA942303
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

CAT siRNA

20-abx900807
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT siRNA

20-abx910366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT siRNA

20-abx910367
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pCas9- CAT

PVT11001 2 ug
EUR 301

pOTB7-CAT

PVT18217 2 ug
EUR 231

Bio-Star Mastermix for probes (2X)

P120 100 rcs (2,5 ml)
EUR 94

Bio-Star Mastermix (2X) High-ROX

P140 100 rcs (2,5 ml)
EUR 102

Bio-Star Mastermix (2X) Low-ROX

P150 100 rcs (2,5 ml)
EUR 102

Recombinant ASFV Ken-031 Protein (aa 1-319)

VAng-0808Lsx-1mg 1 mg
EUR 4504
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7)

Recombinant ASFV Ken-031 Protein (aa 1-319)

VAng-0808Lsx-500g 500 µg
EUR 2993
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7)

Recombinant ASFV Ken-031 Protein (aa 1-319)

VAng-0808Lsx-50g 50 µg
EUR 2044
Description: African swine fever virus (isolate Pig/Kenya/KEN-50/1950) Protein MGF 360-8L (Ken-031), recombinant protein from E. coli. (Uniprot ID: P0C9N7)

Recombinant ASFV War-031 Protein (aa 1-353)

VAng-0996Lsx-1mg 1 mg
EUR 4724
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6)

Recombinant ASFV War-031 Protein (aa 1-353)

VAng-0996Lsx-500g 500 µg
EUR 3143
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6)

Recombinant ASFV War-031 Protein (aa 1-353)

VAng-0996Lsx-50g 50 µg
EUR 2154
Description: African swine fever virus (isolate Warthog/Namibia/Wart80/1980) Protein MGF 360-11L (War-031), recombinant protein from E. coli. (Uniprot ID: P0C9P6)

Recombinant ASFV Pret-031 Protein (aa 1-352)

VAng-2323Lsx-1mg 1 mg
EUR 4724
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2)

Recombinant ASFV Pret-031 Protein (aa 1-352)

VAng-2323Lsx-500g 500 µg
EUR 3143
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2)

Recombinant ASFV Pret-031 Protein (aa 1-352)

VAng-2323Lsx-50g 50 µg
EUR 2140
Description: African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996) Protein MGF 360-9L (Pret-031), recombinant protein from E. coli. (Uniprot ID: P0C9P2)

Bio-Star Mastermix with SYBR (2X) BLUE

Y220 100 rcs (2,5 ml)
EUR 94

Cat RBC antibody

20R-RR015 20 mg
EUR 327
Description: Rabbit polyclonal Cat RBC antibody

Cat RBC antibody

20R-RR016 5 mg
EUR 554
Description: Rabbit polyclonal Cat RBC antibody

Feline Cat IgG

31-1005 5 mg
EUR 175
Description: Feline (Cat) IgG Purified-Protein A

b-cat antibody

70R-21460 50 ul
EUR 435
Description: Rabbit polyclonal b-cat antibody

Cat IgG (FITC)

65C-CH0202 1 mg
EUR 227
Description: Purified Cat IgG FITC conjugate

Cat IgG (HRP)

65C-CH0203 1 mg
EUR 248
Description: Purified Cat IgG HRP conjugate

CAT Rabbit pAb

A11777-100ul 100 ul
EUR 308

CAT Rabbit pAb

A11777-200ul 200 ul
EUR 459

CAT Rabbit pAb

A11777-20ul 20 ul
EUR 183

CAT Rabbit pAb

A11777-50ul 50 ul
EUR 223

CAT Rabbit pAb

A11780-100ul 100 ul
EUR 308

CAT Rabbit pAb

A11780-200ul 200 ul
EUR 459

CAT Rabbit pAb

A11780-20ul 20 ul
EUR 183

CAT Rabbit pAb

A11780-50ul 50 ul
EUR 223

Normal Cat Serum

88R-1026 10 ml
EUR 250
Description: Normal Cat Serum which has been lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2

Catalase (CAT) Antibody

abx025488-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx004037
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx214177
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx175722
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Catalase (CAT) Antibody

20-abx100146
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100147
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100148
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100149
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx100150
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx100151
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx111432
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx125619
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx125620
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx132110
  • EUR 272.00
  • EUR 592.00
  • EUR 314.00
  • EUR 154.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx132122
  • EUR 300.00
  • EUR 718.00
  • EUR 384.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

PKA CAT Antibody

abx147539-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx148940
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx141181
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx171619
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cat Uromodulin Enzyme

20-abx073947
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 0.1 mg
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx034033-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx034033-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx242079
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

PKA CAT Antibody

AF5450 200ul
EUR 304
Description: PKA CAT Antibody detects endogenous levels of total PKA CAT.

CAT Conjugated Antibody

C36312 100ul
EUR 397

Catalase (CAT) Antibody

20-abx326479
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx323535
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx430824-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Catalase (CAT) Antibody

abx231301-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PKA CAT Antibody

AF7746 200ul
EUR 376
Description: PKA CAT Antibody detects endogenous levels of PKA CAT.

CAT cloning plasmid

CSB-CL004563HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTG
  • Show more
Description: A cloning plasmid for the CAT gene.

PKA CAT Antibody

ABF5450 100 ug
EUR 438

CAT Rabbit pAb

A5275-100ul 100 ul
EUR 308

CAT Rabbit pAb

A5275-200ul 200 ul
EUR 459

CAT Rabbit pAb

A5275-20ul 20 ul Ask for price

CAT Rabbit pAb

A5275-50ul 50 ul Ask for price

Recombinant Human CAT

P0501 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P04040
Description: Recombinant Human protein for CAT

pCEP4- CAT Plasmid

PVT1038 2 ug
EUR 266

Rat Catalase (CAT)

QY-E11654 96T
EUR 374

Recombinant Catalase (CAT)

4-RPC418Hu01
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Hu02
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Hu03
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Hu04
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Mu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24270
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Mu02
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24270
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

pCMV-SPORT6-CAT

PVT14338 2 ug
EUR 495

Anti-CAT antibody

STJ27228 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody

STJ113361 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody

STJ113364 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody

STJ119991 100 µl
EUR 413
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Catalase (10,000-15,000 U/mg), Bovine Liver

CAT-01 25 mU
EUR 529

Catalase (2000-4000 U/mg), Aspergillus Niger

CAT-02 25 mU
EUR 651

Catalase (4000-6000 U/mg), Bovine Liver

CAT-03 5 mU
EUR 347

Catalase (>40,000 u/mg), Bovine Liver

CAT-04 1 mg
EUR 286

anti-XPA (human) antibody, monoclonal

70-031 50ug
EUR 414
Description: The anti-XPA (human) antibody, monoclonal is available in Europe and for worldwide shipping via Gentaur.

Pfu DNA polymerase (-dNTPs)

02-031 200U
EUR 166
Description: The Pfu DNA polymerase (-dNTPs) is available in Europe and for worldwide shipping via Gentaur.

Recombinant Dengue Virus Subtype 3 EP (aa 281-673)

DAGF-031 2 ug
EUR 372

Recombinant Mouse C1s1 Protein

CTP-031 100ug Ask for price
Description: A recombinant mouse C1s1 protein with a N-terminal tag or C-terminal tag expressed in E. coli, yeast, insect, or mammalian cells.

IGF1

E21-031 10ug
EUR 343

Goat Anti-Malondialdehyde (MDA) Polyclonal Antibody

STA-031 100 µg
EUR 508
Description: Goat Anti-Malondialdehyde Polyclonal Antibody is Affinity purified and suitable for Western blot or ELISA. Suitable for use with any species. 100 µg.