Accuplex On Cat

Lab Reagents

Human IgG antibody Laboratories manufactures the accuplex on cat reagents distributed by Genprice. The Accuplex On Cat reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SeraCare Inc.. Other Accuplex products are available in stock. Specificity: Accuplex Category: On Group: Cat

Cat information

Rat Catalase (CAT) ELISA Kit

RDR-CAT-Ra-96Tests 96 Tests
EUR 811

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-48Tests 48 Tests
EUR 436

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-96Tests 96 Tests
EUR 601

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-48Tests 48 Tests
EUR 533

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-96Tests 96 Tests
EUR 740

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-48Tests 48 Tests
EUR 557

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-96Tests 96 Tests
EUR 775

Human Osteonectin (ON) ELISA Kit

DLR-ON-Hu-48T 48T
EUR 479
  • Should the Human Osteonectin (ON) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Osteonectin (ON) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Osteonectin (ON) ELISA Kit

DLR-ON-Hu-96T 96T
EUR 621
  • Should the Human Osteonectin (ON) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Osteonectin (ON) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Osteonectin (ON) ELISA Kit

DLR-ON-Mu-48T 48T
EUR 489
  • Should the Mouse Osteonectin (ON) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Osteonectin (ON) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Osteonectin (ON) ELISA Kit

DLR-ON-Mu-96T 96T
EUR 635
  • Should the Mouse Osteonectin (ON) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Osteonectin (ON) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Osteonectin (ON) ELISA Kit

DLR-ON-Ra-48T 48T
EUR 508
  • Should the Rat Osteonectin (ON) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Osteonectin (ON) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Osteonectin (ON) ELISA Kit

DLR-ON-Ra-96T 96T
EUR 661
  • Should the Rat Osteonectin (ON) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Osteonectin (ON) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Osteonectin (ON) ELISA Kit

RDR-ON-Hu-48Tests 48 Tests
EUR 500

Human Osteonectin (ON) ELISA Kit

RDR-ON-Hu-96Tests 96 Tests
EUR 692

Mouse Osteonectin (ON) ELISA Kit

RDR-ON-Mu-48Tests 48 Tests
EUR 511

Mouse Osteonectin (ON) ELISA Kit

RDR-ON-Mu-96Tests 96 Tests
EUR 709

Rat Osteonectin (ON) ELISA Kit

RDR-ON-Ra-48Tests 48 Tests
EUR 534

Rat Osteonectin (ON) ELISA Kit

RDR-ON-Ra-96Tests 96 Tests
EUR 742

Human Osteonectin (ON) ELISA Kit

RD-ON-Hu-48Tests 48 Tests
EUR 478

Human Osteonectin (ON) ELISA Kit

RD-ON-Hu-96Tests 96 Tests
EUR 662

Mouse Osteonectin (ON) ELISA Kit

RD-ON-Mu-48Tests 48 Tests
EUR 489

Mouse Osteonectin (ON) ELISA Kit

RD-ON-Mu-96Tests 96 Tests
EUR 677

Rat Osteonectin (ON) ELISA Kit

RD-ON-Ra-48Tests 48 Tests
EUR 511

Rat Osteonectin (ON) ELISA Kit

RD-ON-Ra-96Tests 96 Tests
EUR 709

CAT/ Rat CAT ELISA Kit

ELA-E0242r 96 Tests
EUR 886

ON/ Rat ON ELISA Kit

ELA-E0791r 96 Tests
EUR 886

CAT antibody

20C-CR1111RP 500 ul
EUR 262
Description: Rabbit polyclonal CAT antibody

CAT antibody

70R-16187 50 ul
EUR 435
Description: Rabbit polyclonal CAT antibody

CAT Antibody

36312-100ul 100ul
EUR 252

Cat IgM

31C-CH0213 1 mg
EUR 392
Description: Purified Cat IgM

CAT antibody

10R-3584 100 ul
EUR 726
Description: Mouse monoclonal CAT antibody

CAT antibody

10R-3585 100 ul
EUR 691
Description: Mouse monoclonal CAT antibody

CAT Antibody

1-CSB-PA004563GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CAT Antibody

1-CSB-PA004980
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CAT Antibody

1-CSB-PA070043
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

CAT Antibody

1-CSB-PA599838
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CAT Antibody

1-CSB-PA942303
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

CAT siRNA

20-abx900807
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT siRNA

20-abx910366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT siRNA

20-abx910367
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pCas9- CAT

PVT11001 2 ug
EUR 301

pOTB7-CAT

PVT18217 2 ug
EUR 231

ON-013100

B1276-25
EUR 675

ON-013100

B1276-5
EUR 207

ON-01910

E1KS1362 5mg
EUR 874

Boc-ON

A7004-100000 100 g
EUR 216
Description: Boc-ON

Boc-ON

A7004-25000 25 g
EUR 96
Description: Boc-ON

ON-013100

HY-112822 100mg
EUR 1106

ON 146040

HY-12338 100mg
EUR 2943

pTet- On

PVT11007 2 ug
EUR 301

pRI201- ON

PVT11186 2 ug
EUR 370

Cat RBC antibody

20R-RR015 20 mg
EUR 327
Description: Rabbit polyclonal Cat RBC antibody

Cat RBC antibody

20R-RR016 5 mg
EUR 554
Description: Rabbit polyclonal Cat RBC antibody

Feline Cat IgG

31-1005 5 mg
EUR 175
Description: Feline (Cat) IgG Purified-Protein A

b-cat antibody

70R-21460 50 ul
EUR 435
Description: Rabbit polyclonal b-cat antibody

Cat IgG (FITC)

65C-CH0202 1 mg
EUR 227
Description: Purified Cat IgG FITC conjugate

Cat IgG (HRP)

65C-CH0203 1 mg
EUR 248
Description: Purified Cat IgG HRP conjugate

CAT Rabbit pAb

A11777-100ul 100 ul
EUR 308

CAT Rabbit pAb

A11777-200ul 200 ul
EUR 459

CAT Rabbit pAb

A11777-20ul 20 ul
EUR 183

CAT Rabbit pAb

A11777-50ul 50 ul
EUR 223

CAT Rabbit pAb

A11780-100ul 100 ul
EUR 308

CAT Rabbit pAb

A11780-200ul 200 ul
EUR 459

CAT Rabbit pAb

A11780-20ul 20 ul
EUR 183

CAT Rabbit pAb

A11780-50ul 50 ul
EUR 223

Normal Cat Serum

88R-1026 10 ml
EUR 250
Description: Normal Cat Serum which has been lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2

Catalase (CAT) Antibody

abx025488-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx004037
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx214177
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx175722
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Catalase (CAT) Antibody

20-abx100146
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100147
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100148
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100149
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx100150
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx100151
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx111432
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx125619
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx125620
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx132110
  • EUR 272.00
  • EUR 592.00
  • EUR 314.00
  • EUR 154.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx132122
  • EUR 300.00
  • EUR 718.00
  • EUR 384.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

PKA CAT Antibody

abx147539-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx148940
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx141181
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx171619
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cat Uromodulin Enzyme

20-abx073947
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 0.1 mg
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx034033-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx034033-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx242079
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

PKA CAT Antibody

AF5450 200ul
EUR 304
Description: PKA CAT Antibody detects endogenous levels of total PKA CAT.

CAT Conjugated Antibody

C36312 100ul
EUR 397

Catalase (CAT) Antibody

20-abx326479
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx323535
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx430824-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Catalase (CAT) Antibody

abx231301-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PKA CAT Antibody

AF7746 200ul
EUR 376
Description: PKA CAT Antibody detects endogenous levels of PKA CAT.

CAT cloning plasmid

CSB-CL004563HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTG
  • Show more
Description: A cloning plasmid for the CAT gene.

PKA CAT Antibody

ABF5450 100 ug
EUR 438

CAT Rabbit pAb

A5275-100ul 100 ul
EUR 308

CAT Rabbit pAb

A5275-200ul 200 ul
EUR 459

CAT Rabbit pAb

A5275-20ul 20 ul Ask for price

CAT Rabbit pAb

A5275-50ul 50 ul Ask for price

Recombinant Human CAT

P0501 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P04040
Description: Recombinant Human protein for CAT

pCEP4- CAT Plasmid

PVT1038 2 ug
EUR 266

Rat Catalase (CAT)

QY-E11654 96T
EUR 374

Recombinant Catalase (CAT)

4-RPC418Hu01
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Hu02
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Hu03
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Hu04
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Mu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24270
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

Recombinant Catalase (CAT)

4-RPC418Mu02
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24270
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

pCMV-SPORT6-CAT

PVT14338 2 ug
EUR 495

Anti-CAT antibody

STJ27228 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody

STJ113361 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody

STJ113364 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody

STJ119991 100 µl
EUR 413
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Catalase (10,000-15,000 U/mg), Bovine Liver

CAT-01 25 mU
EUR 529

Catalase (2000-4000 U/mg), Aspergillus Niger

CAT-02 25 mU
EUR 651

Catalase (4000-6000 U/mg), Bovine Liver

CAT-03 5 mU
EUR 347

Catalase (>40,000 u/mg), Bovine Liver

CAT-04 1 mg
EUR 286

ON-OFF cock

2393207 10unit
EUR 264

Osteonectin (ON) Antibody

20-abx177883
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Osteonectin (ON) Antibody

20-abx177884
  • EUR 425.00
  • EUR 133.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Osteonectin (ON) Antibody

20-abx100386
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Osteonectin (ON) Antibody

20-abx100387
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Osteonectin (ON) Antibody

20-abx128539
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Osteonectin (ON) Antibody

20-abx173915
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Osteonectin (ON) Antibody

20-abx173916
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Osteonectin (ON)

4-RPA791Hu01
  • EUR 377.76
  • EUR 204.00
  • EUR 1141.60
  • EUR 447.20
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P09486
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.2kDa
  • Isoelectric Point: 5
Description: Recombinant Human Osteonectin expressed in: E.coli

Recombinant Osteonectin (ON)

4-RPA791Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07214
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Osteonectin expressed in: E.coli

Recombinant Osteonectin (ON)

4-RPA791Ra01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P16975
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.5kDa
  • Isoelectric Point: 4.7
Description: Recombinant Rat Osteonectin expressed in: E.coli

Recombinant Osteonectin (ON)

4-RPA791Rb01
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P36233
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.8kDa
  • Isoelectric Point: 5.2
Description: Recombinant Rabbit Osteonectin expressed in: E.coli

pTet- On- Advanced

PVT11006 2 ug
EUR 301

pTetracycline- On Plasmid

PVT1404 2 ug
EUR 266

Cat IgG (Fab) (FITC)

65C-CH0211 1 mg
EUR 248
Description: Purified Cat IgG (Fab) FITC conjugate

Cat IgG (Fab) (HRP)

65C-CH0212 1 mg
EUR 297
Description: Purified Cat IgG (Fab) HRP conjugate

Anti-CPN cat Antibody

A05704 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CPN cat Antibody (CPN1) detection. Tested with WB in Human.

Cat IgG (Fab'2)

31C-CH0207 1 mg
EUR 341
Description: Purified Cat IgG (Fab'2)

Cat RBC antibody (FITC)

60R-RR012FT 3 mg
EUR 392
Description: Rabbit polyclonal Cat RBC antibody (FITC) conjugated

Goat anti Cat IgG

40C-CB0215 2 mg
EUR 271
Description: Goat anti Cat IgG secondary antibody

Rabbit anti Cat IgG

40C-CB0222 2 mg
EUR 248
Description: Rabbit anti Cat IgG secondary antibody

Goat anti Cat IgG

40C-CB0229 2 mg
EUR 234
Description: Goat anti Cat IgG secondary antibody

Cat IgA ELISA Kit

E-20A 1 x 96 well plate
EUR 451

Cat CRP ELISA Kit

E-20CRP 1 x 96 well plate
EUR 461

Cat IgE ELISA Kit

E-20E 1 x 96 well plate
EUR 451

Cat IgG ELISA Kit

E-20G 1 x 96 well plate
EUR 461

Cat Haptoglobin ELISA Kit

E-20HPT 1 x 96 well plate
EUR 461

Cat IgM ELISA Kit

E-20M 1 x 96 well plate
EUR 461

Cat SAA ELISA Kit

E-20SAA 1 x 96 well plate
EUR 461

Phospho-CAT (Y386) Antibody

1-CSB-PA070042
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CAT (Y386). Recognizes Phospho-CAT (Y386) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

CAT protein (His tag)

80R-2367 100 ug
EUR 327
Description: Purified recombinant Human CAT protein (His tag)

Human Catalase (CAT) Protein

20-abx065785
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Catalase (CAT) Protein

20-abx065786
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Catalase (CAT) Protein

20-abx065787
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Catalase (CAT) Protein

20-abx065788
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Catalase (CAT) Protein

20-abx065789
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Catalase (CAT) Protein

20-abx065790
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human CAT ELISA Kit

ELA-E0242h 96 Tests
EUR 824

Human CAT ELISA Kit

EHC0093 96Tests
EUR 521

Goat CAT ELISA Kit

EGTC0093 96Tests
EUR 521

Bovine CAT ELISA Kit

EBC0093 96Tests
EUR 521

Canine CAT ELISA Kit

ECC0093 96Tests
EUR 521

Chicken CAT ELISA Kit

ECKC0093 96Tests
EUR 521

Anserini CAT ELISA Kit

EAC0009 96Tests
EUR 521

Anserini CAT ELISA Kit

EAC0093 96Tests
EUR 521

CAT ELISA KIT|Human

EF000414 96 Tests
EUR 689

Recombinant Human Catalase/CAT

CE86-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Catalase/CAT

CE86-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Catalase/CAT

CE86-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Catalase/CAT

CE86-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Polyclonal CAT / Catalase Antibody

APG02430G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CAT / Catalase . This antibody is tested and proven to work in the following applications:

Monoclonal CAT / Catalase Antibody

APG02431G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human CAT / Catalase. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P

PKA CAT Blocking Peptide

AF5450-BP 1mg
EUR 195

Rat CAT shRNA Plasmid

20-abx984402
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CAT Polyclonal Conjugated Antibody

C30258 100ul
EUR 397

Polyclonal CAT Antibody (Center)

APR07030G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CAT (Center). This antibody is tested and proven to work in the following applications:

Catalase (CAT) Antibody (Biotin)

20-abx272269
  • EUR 398.00
  • EUR 230.00
  • EUR 1080.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody (Biotin)

20-abx272828
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Catalase (CAT) Protein

20-abx652798
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Catalase (CAT) Antibody (FITC)

20-abx273631
  • EUR 411.00
  • EUR 230.00
  • EUR 1163.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Catalase (CAT) Antibody (FITC)

20-abx273894
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

PKA CAT Blocking Peptide

AF7746-BP 1mg
EUR 195

Mouse CAT shRNA Plasmid

20-abx969476
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CAT shRNA Plasmid

20-abx950601
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CPN cat Polyclonal Antibody

ABP51042-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CPN cat at AA range: 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of CPN cat from Human. This CPN cat antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CPN cat at AA range: 380-460

CPN cat Polyclonal Antibody

ABP51042-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CPN cat at AA range: 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of CPN cat from Human. This CPN cat antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CPN cat at AA range: 380-460

CPN cat Polyclonal Antibody

ABP51042-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CPN cat at AA range: 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of CPN cat from Human. This CPN cat antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CPN cat at AA range: 380-460

CAT-4 Polyclonal Antibody

ABP56232-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CAT-4 at AA range: 530-610
  • Applications tips:
Description: A polyclonal antibody for detection of CAT-4 from Human. This CAT-4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CAT-4 at AA range: 530-610